COVID-19 Genome Analysis Summaries

COVID-19 Genome Analysis Summaries provide up-to-date and concise summaries of genomes of SARS-nCoV-2 Genomes from across the world.
Credits

COVID-19 is indebted to contributions from a number of individuals who have contributed to data curation and analysis. 

Mercy Rophina (Genome Collection / Variant Analysis)
Abhinav Jain & Samatha Mathew (Primer/Probe Collection)
Bani Jolly (Phylogenetic Analysis)
Kavita Pandhare (COVID-19 Genomepedia dev/ops)
Vinod Scaria & Sridhar Sivasubbu (Concept / Overviews)
Volunteer contributors who have contributed to the data collection and analysis 

Members of Vinod Scaria & Sridhar Sivasubbu Labs at 
CSIR Institute of Genomics and Integrative Biology (CSIR-IGIB)

COVID-19 Open Research, Data and Resources

Genomic variants in SARS-CoV-2 isolates from India and its impact on diagnostic assays - what we need to know

posted Aug 20, 2020, 11:34 PM by Vinod Scaria

We catalogued a total of 132 primers or probes sequences from the literature and the public domain. Our analysis revealed a total of 125 unique genetic variants in 80 either primers or probes binding sites. A total of 13 unique variants had allele frequency of ≥ 1% in Indian SARS-CoV-2 genomes mapped to the primers or probes binding sites. A total of 15 primers or probes binding sites had cumulative variant frequency of ≥ 1% in the SARS-CoV-2 genomes. These included primers or probes sites which are widely used in India and across the world for molecular diagnosis as well as approved by national and international agencies. This highlights the need for sequencing genomes of emerging pathogens to make evidence based policies for development and approval of diagnostics. To the best of our knowledge, ours is the most comprehensive analysis of genomic variants in genomes of SARS-CoV-2 isolates from India and their potential impact on efficacy of molecular diagnostics.


Read more on the preprint here

GENETIC DIVERSITY OF INDIAN SARS-NCOV-2 ISOLATES 15/05/2020

posted May 14, 2020, 8:19 AM by Vinod Scaria   [ updated May 14, 2020, 8:20 AM ]


Credits:  
Inforgraphics: Bani Jolly 
Data Source: GISAID 
Acknowledge data submitted from NIMHANS Bengaluru, NCDC Delhi, ICMR NIV Pune, NIBMG Kalyani, GBRC Gandhinagar and Gandhi Medical College, Secunderabad 

Methods and Resources
Find a browseable version of the tree at http://bit.ly/c19phylovis
The Detailed methods are available at http://bit.ly/3bklQa2

Genetic Diversity of Indian SARS-nCoV-2 Isolates 09/05/2020

posted May 9, 2020, 12:26 AM by Vinod Scaria   [ updated May 9, 2020, 1:09 AM ]



Credits:  
Inforgraphics: Bani Jolly 
Data Source: GISAID 
Acknowledge data submitted from NIMHANS Bengaluru, NCDC Delhi, ICMR NIV Pune, NIBMG Kalyani, GBRC Gandhinagar and Gandhi Medical College, Secunderabad 

Methods and Resources
Find a browseable version of the tree at http://bit.ly/c19phylovis
The Detailed methods are available at http://bit.ly/3bklQa2


N Gene Primers / Probes

posted Apr 22, 2020, 9:40 PM by Vinod Scaria   [ updated Apr 23, 2020, 8:10 AM ]


Update e1 dated 21-04-2020 

SUMMARY 
N Gene primer / probe sites have a high frequency of variants in global genomes of SARS-nCoV-2 with potential detrimental effect on diagnostic efficiencies.


DATA SUMMARY 
Date of Data Download: 15.04.2020
Genomes Analysed : 9284
Genomes Considered for downstream analysis : 6187
Unique Variants Called: 10,930 

VARIANT FREQUENCIES IN PRIMER / PROBE SITES IN SARS-nCOV-2 GENOMES

Gene  Primer/Probe Sequence Cumulative Variant Freq # Indian Genomes
N gene  GGGGAACTTCTCCTGCTAGAAT 26.98 12
N gene  TTGCTGCTGCTTGACAGATT 9.08 0
N gene  GGGAGCCTTGAATACACCAAAA 1.58 0
N gene  TGAACTGTTGCGACTACGTG 1.23 0
N gene  TAATCAGACAAGGAACTGATTA 0.65 0
N gene  GAGGAACGAGAAGAGGCTTG 0.56 0
N gene  GTTGCGACTACGTGATGAGG 0.5 0
N gene  CAGACATTTTGCTCTCAAGCTG 0.48 0
N gene  ACCCCGCATTACGTTTGGTGGACC 0.47 0
N gene  ACAATTTGCCCCCAGCGCTTCAG 0.47 0
N gene  AAATTTTGGGGACCAGGAAC 0.39 0
N gene  CCCCACTGCGTTCTCCATT 0.37 0
N gene  AGCACCATAGGGAAGTCC 0.37 0
N gene  CGAAGGTGTGACTTCCATG 0.34 0
N gene  TGTAGCACGATTGCAGCATTG 0.31 0
N gene  GACCCCAAAATCAGCGAAAT 0.29 0
N gene  GCTGCAATCGTGCTACAACT 0.29 0
N gene  CACATTGGCACCCGCAATC 0.27 0
N gene  CAATGCTGCAATCGTGCTAC 0.27 0
N gene  TCTGGTTACTGCCAGTTGAATCTG 0.26 0
N gene  AYCACATTGGCACCCGCAATCCTG 0.24 0
N gene  ATGTCGCGCATTGGCATGGA 0.24 0
N gene  TTACAAACATTGGCCGCAAA 0.21 0
N gene  GCGCGACATTCCGAAGAA 0.18 0
N gene  TGGCAGCTGTGTAGGTCAAC 0.16 0
N gene  CGTTTGGTGGACCCTCAGAT 0.11 0
COVID-19 GENOMEPEDIA
COVID-19 Genomepedia is a searchable catalog of SARS-nCoV-2 genomes from around the world

COVID-19 Primer/Probe Collection
The primer/probe information for most of the diagnostic kits are not readily available in public domain. We hope to make this information available for the general interest of public. Such a collection would help understand and compare the efficacy of the reagents and also be able to ascertain whether the virus evolution would have an impact on the accuracy of the reagents. [Contribute to the collection]

Compendium of Diagnostics and Screening assays
The online compendium lists all diagnostics and screening assays available across the world and their status as approved by different regulatory agencies including USFDA, Europe (CE-IVD), China FDA, India (ICMR/CDSCO) apart from others. Please feel free to contribute to the collection, if you do not find a particular listing.


Introducing the Workflow for Data Analysis

posted Apr 15, 2020, 12:53 AM by Vinod Scaria   [ updated Apr 15, 2020, 1:02 AM ]


This section summarizes the analysis workflow followed for generating the information that goes into each of the Genome Analysis Summaries report. The data sources are linked appropriately for reference.

Introducing the Workflow for Data Analysis

Genomes Analysed
The genomes analysed are from the listings available at COVID-19 Genomepedia maintained by the Vinod Scaria Lab at CSIR Institute of Genomics and Integrative Biology.

Reference Alignment
Reference alignment of the genomes are accomplished by EMBOSS needle 
Reference genome considered for all analysis is NC_045512 available from Genbank

Primer Probe Information
The primer/probe information analysed is from a crowd-sourced compendium created as part of the COVID-19 Open Research, Data and Resources.



1-5 of 5