N Gene Primers / Probes

posted Apr 22, 2020, 9:40 PM by Vinod Scaria   [ updated Apr 23, 2020, 8:10 AM ]

Update e1 dated 21-04-2020 

SUMMARY 
N Gene primer / probe sites have a high frequency of variants in global genomes of SARS-nCoV-2 with potential detrimental effect on diagnostic efficiencies.


DATA SUMMARY 
Date of Data Download: 15.04.2020
Genomes Analysed : 9284
Genomes Considered for downstream analysis : 6187
Unique Variants Called: 10,930 

VARIANT FREQUENCIES IN PRIMER / PROBE SITES IN SARS-nCOV-2 GENOMES

Gene  Primer/Probe Sequence Cumulative Variant Freq # Indian Genomes
N gene  GGGGAACTTCTCCTGCTAGAAT 26.98 12
N gene  TTGCTGCTGCTTGACAGATT 9.08 0
N gene  GGGAGCCTTGAATACACCAAAA 1.58 0
N gene  TGAACTGTTGCGACTACGTG 1.23 0
N gene  TAATCAGACAAGGAACTGATTA 0.65 0
N gene  GAGGAACGAGAAGAGGCTTG 0.56 0
N gene  GTTGCGACTACGTGATGAGG 0.5 0
N gene  CAGACATTTTGCTCTCAAGCTG 0.48 0
N gene  ACCCCGCATTACGTTTGGTGGACC 0.47 0
N gene  ACAATTTGCCCCCAGCGCTTCAG 0.47 0
N gene  AAATTTTGGGGACCAGGAAC 0.39 0
N gene  CCCCACTGCGTTCTCCATT 0.37 0
N gene  AGCACCATAGGGAAGTCC 0.37 0
N gene  CGAAGGTGTGACTTCCATG 0.34 0
N gene  TGTAGCACGATTGCAGCATTG 0.31 0
N gene  GACCCCAAAATCAGCGAAAT 0.29 0
N gene  GCTGCAATCGTGCTACAACT 0.29 0
N gene  CACATTGGCACCCGCAATC 0.27 0
N gene  CAATGCTGCAATCGTGCTAC 0.27 0
N gene  TCTGGTTACTGCCAGTTGAATCTG 0.26 0
N gene  AYCACATTGGCACCCGCAATCCTG 0.24 0
N gene  ATGTCGCGCATTGGCATGGA 0.24 0
N gene  TTACAAACATTGGCCGCAAA 0.21 0
N gene  GCGCGACATTCCGAAGAA 0.18 0
N gene  TGGCAGCTGTGTAGGTCAAC 0.16 0
N gene  CGTTTGGTGGACCCTCAGAT 0.11 0
COVID-19 GENOMEPEDIA
COVID-19 Genomepedia is a searchable catalog of SARS-nCoV-2 genomes from around the world

COVID-19 Primer/Probe Collection
The primer/probe information for most of the diagnostic kits are not readily available in public domain. We hope to make this information available for the general interest of public. Such a collection would help understand and compare the efficacy of the reagents and also be able to ascertain whether the virus evolution would have an impact on the accuracy of the reagents. [Contribute to the collection]

Compendium of Diagnostics and Screening assays
The online compendium lists all diagnostics and screening assays available across the world and their status as approved by different regulatory agencies including USFDA, Europe (CE-IVD), China FDA, India (ICMR/CDSCO) apart from others. Please feel free to contribute to the collection, if you do not find a particular listing.